|
|
Marker Overview
| Name | Cp1998 |
|---|
| Genbank ID | DC898461 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Cp1998.Forward Primer: AGTCCATCTGTGCACGAG |
|---|
| Primer 2 | Cp1998.Reverse Primer: AATAAATGTGGTCCTGATCAA |
|---|
| Restriction Enzyme | NdeII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Shi LB, Tang PF, Zhang W, Zhao YP, Zhang LC, Zhang H. Naringenin inhibits spinal cord injury-induced activation of neutrophils through miR-223. Gene. 2016 Jul 15. |
|
