Cte997, Cte997 (genetic_marker) Citrus spp.

Marker Overview
NameCte997
Genbank IDDC895780
Typegenetic marker
SpeciesCitrus spp.
Primer 1Cte997.Forward Primer: AGACATTGCCGACACATT
Primer 2Cte997.Reverse Primer: CATTTCAACCTTACCCAAGTT
Restriction EnzymeHaeIII
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCte997.Forward PrimerCitrus spp.primer
Reverse PrimerCte997.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Cte997Cte997Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Citrus_hassaku/FlyingDragon//Kiyomi//Kankitsu_Chukanbohon_Nou_8_Gou/Siamese_Acidless-BC2-2015Nou-8-06N/A88Cte997View