|
|
Marker Overview
| Name | Fb0296 |
|---|
| Genbank ID | DC888235 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Fb0296.Forward Primer: GAGTCGCTGGGGAGATT |
|---|
| Primer 2 | Fb0296.Reverse Primer: GTACAATGAAACGGCAAGTTA |
|---|
| Restriction Enzyme | MspI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Sun HP, Li F, Ruan QM, Zhong XH. Identification and validation of reference genes for quantitative real-time PCR studies in Hedera helix L. Plant physiology and biochemistry : PPB / Societe francaise de physiologie vegetale. 2016 Jul 22; 108:286-294. |
|
