Lp0103, Lp0103 (genetic_marker) Citrus spp.

Marker Overview
NameLp0103
Genbank IDAU300840
Typegenetic marker
SpeciesCitrus spp.
Primer 1Lp0103.Forward Primer: GTACGACTTGGTGATGC
Primer 2Lp0103.Reverse Primer: TTTGGGAATAGTGCTACAATA
Restriction EnzymeStyI
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLp0103.Forward PrimerCitrus spp.primer
Reverse PrimerLp0103.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lp0103Lp0103Citrus spp.marker_locus