|
|
Marker Overview
| Name | Lp0122 |
|---|
| Genbank ID | AU300471 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Lp0122.Forward Primer: GAGATCGTTTTGAGCGGATTC |
|---|
| Primer 2 | Lp0122.Reverse Primer: CCAAACCAAAAGTCGGGAGAT |
|---|
| Restriction Enzyme | PvuII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Chen ZT, Mu LX, Wang JR, Du YZ. Complete Mitochondrial Genome of the Citrus Spiny Whitefly Aleurocanthus spiniferus (Quaintance) (Hemiptera: Aleyrodidae): Implications for the Phylogeny of Whiteflies. PloS one. 2016; 11(8):e0161385. |
|
