|
Marker Overview
Name | Lp0229 |
Genbank ID | AU300641 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Lp0229.Forward Primer: CCCCTTTAATCAATCTTCTGA |
Primer 2 | Lp0229.Reverse Primer: CCCCACTATGAGGAGACAATA |
Restriction Enzyme | MspI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Sharma N, Selvakumar P, Saini G, Warghane A, Ghosh DK, Sharma AK. Crystal structure analysis in Zn(2+)-bound state and biophysical characterization of CLas-ZnuA2. Biochimica et biophysica acta. 2016 Aug 26. |
|