|
Marker Overview
Name | Mf0089 |
Genbank ID | C81889 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Mf0089.Forward Primer: GTGGTGGTGATGGTGCTGCCA |
Primer 2 | Mf0089.Reverse Primer: TACAACTGAGCACATCACATG |
Restriction Enzyme | NC |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Gómez-Muñoz N, Velázquez K, Vives MC, Ruiz-Ruiz S, Pina JA, Flores R, Moreno P, Guerri J. The resistance of sour orange to Citrus tristeza virus is mediated by both the salycilic acid and the RNA silencing defense pathways. Molecular plant pathology. 2016 Sep 2. |
|