|
Marker Overview
Name | Ov0112 |
Genbank ID | AU186405 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Ov0112.Forward Primer: ATCACCCAATCTTGAATGC |
Primer 2 | Ov0112.Reverse Primer: GGAATTTATTGAAAGCCAAAA |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Harper SJ, Killiny N, Tatineni S, Gowda S, Cowell SJ, Shilts T, Dawson WO. Sequence variation in two genes determines the efficacy of transmission of citrus tristeza virus by the brown citrus aphid. Archives of virology. 2016 Sep 19. |
|