Ov0301, Ov0301 (genetic_marker) Citrus spp.

Marker Overview
NameOv0301
Genbank IDAU186450
Typegenetic marker
SpeciesCitrus spp.
Primer 1Ov0301.Forward Primer: TCCGAATTGCCGTGTTGTA
Primer 2Ov0301.Reverse Primer: GTATATGACCCGACCCGAATC
Restriction EnzymePvuII
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerOv0301.Forward PrimerCitrus spp.primer
Reverse PrimerOv0301.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ov0301Ov0301Citrus spp.marker_locus