|
Marker Overview
Name | Ov0404 |
Genbank ID | AU186517 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Ov0404.Forward Primer: AGGAAGCGTTAAGCAAAGTTC |
Primer 2 | Ov0404.Reverse Primer: TAGATCTAGCACCCCAGCAT |
Restriction Enzyme | EcoRV |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Goulin EH, Savi DC, Petters DA, Kava V, Galli-Terasawa L, Silva GJ, Glienke C. Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation. Microbiological research. 2016 Nov; 192:142-7. |
|