|
Marker Overview
Name | Ov0419 |
Genbank ID | DC893992 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Ov0419.Forward Primer: TCCGGCCCTTCAATCAATCAT |
Primer 2 | Ov0419.Reverse Primer: GCAGCGGAGACCCTGGAG |
Restriction Enzyme | EcoRV |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Tan Z, Cheng J, Liu Q, Zhou L, Wang T, Lin X, Yuan J, Quinn JM, Tickner J, Qin A, Zhao J, Xu J. Neohesperidin suppresses osteoclast differentiation, bone resorption and ovariectomised-induced osteoporosis in mice. Molecular and cellular endocrinology. 2016 Sep 21. |
|