|
Marker Overview
Name | Ov0422 |
Genbank ID | DC893997 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Ov0422.Forward Primer: CGGCCATGGCTTCCTCTAA |
Primer 2 | Ov0422.Reverse Primer: CTCATCCTTTCTCCCCCAATC |
Restriction Enzyme | HincII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Petrocelli S, Arana MR, Cabrini MN, Casabuono AC, Moyano L, Beltramino M, Moreira LM, Couto AS, Orellano EG. Deletion of pilA, a Minor Pilin-Like Gene, from Xanthomonas citri subsp. citri Influences Bacterial Physiology and Pathogenesis. Current microbiology. 2016 Sep 24. |
|