|
Marker Overview
Name | Sz0001 |
Genbank ID | N/A |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Sz0001.Forward Primer: AACGGCGGGCAACTCTTAGT |
Primer 2 | Sz0001.Reverse Primer: GAGGGCATTGTCCGGTATGGG |
Restriction Enzyme | MspI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2017 | Chen XM, Tait AR, Kitts DD. Flavonoid composition of orange peel and its association with antioxidant and anti-inflammatory activities. Food chemistry. 2017 Mar 1; 218:15-21. |
|