|
Marker Overview
Name | Sz0008 |
Genbank ID | N/A |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Sz0008.Forward Primer: GTATGCCATCCCAGCTAATGT |
Primer 2 | Sz0008.Reverse Primer: ACAATTCAAGTCTCGCACCT |
Restriction Enzyme | HindIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | García-Flores LA, Medina S, Oger C, Galano JM, Durand T, Cejuela R, Martínez-Sanz JM, Ferreres F, Gil-Izquierdo Á. Lipidomic approach in young adult triathletes: effect of supplementation with a polyphenols-rich juice on neuroprostane and F2-dihomo-isoprostane markers. Food & function. 2016 Oct 12; 7(10):4343-4355. |
|