|
Marker Overview
Name | Sz0016 |
Genbank ID | N/A |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Sz0016.Forward Primer: GCTTATGTTGATGATGTGGGATATA |
Primer 2 | Sz0016.Reverse Primer: AGGTACTGTTGAATCGCTGAG |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Jannat S, Ali MY, Kim HR, Jung HA, Choi JS. Protective Effects of Sweet Orange, Unshiu Mikan, and Mini Tomato Juice Powders on t-BHP-Induced Oxidative Stress in HepG2 Cells. Preventive nutrition and food science. 2016 Sep; 21(3):208-220. |
|