Tf0142, Tf0142 (genetic_marker) Citrus spp.

Marker Overview
NameTf0142
Genbank IDCF507900
Typegenetic marker
SpeciesCitrus spp.
Primer 1Tf0142.Forward Primer: TACGGAAACCCTACACGATCA
Primer 2Tf0142.Reverse Primer: CGATTGCGTGAAGATTGGTAT
Restriction EnzymeHhaI
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTf0142.Forward PrimerCitrus spp.primer
Reverse PrimerTf0142.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Tf0142Tf0142Citrus spp.marker_locus