Tf0173, Tf0173 (genetic_marker) Citrus spp.

Marker Overview
NameTf0173
Genbank IDC95479
Typegenetic marker
SpeciesCitrus spp.
Primer 1Tf0173.Forward Primer: CACAGGGACAGGGTAGT
Primer 2Tf0173.Reverse Primer: GCGTACTGATTGAACATGATA
Restriction EnzymePvuII
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTf0173.Forward PrimerCitrus spp.primer
Reverse PrimerTf0173.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Tf0173Tf0173Citrus spp.marker_locus