|
Marker Overview
Name | Tf0173 |
Genbank ID | C95479 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Tf0173.Forward Primer: CACAGGGACAGGGTAGT |
Primer 2 | Tf0173.Reverse Primer: GCGTACTGATTGAACATGATA |
Restriction Enzyme | PvuII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Roberts R, Pietersen G. A novel subspecies of 'Candidatus Liberibacter africanus' found on native Teclea gerrardii (Family: Rutaceae) from South Africa. Antonie van Leeuwenhoek. 2016 Nov 9. |
|