|
Marker Overview
Name | Tf0393 |
Genbank ID | CD575586 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Tf0393.Forward Primer: AATCATTCGGCTGTTAGTTA |
Primer 2 | Tf0393.Reverse Primer: ATTGCCTGACATGAACATCGT |
Restriction Enzyme | DraI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Naseem S, Tahir HM. Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders. Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis. 2016 Nov 13; 1-6. |
|