100029460|F|0, 100029460|F|0 (genetic_marker) Citrus spp.

Marker Overview
Name100029460|F|0
Genbank IDN/A
TypeDArT
SpeciesCitrus spp.
Publication[view all]
ContactMariangela Cristofani-Yaly
Contact
NameDetails
Mariangela Cristofani-Yaly
First name:Mariangela
Last name:Cristofani-Yaly
Title:Researcher
Institution:Agronomic Institute of Campinas
Address:Citrus APTA Center ‘Sylvio Moreira’/ Agronomic Institute of Campinas, Sao Paulo, Brazil
Country:Brazil
Email:mariangela@centrodecitricultura.br
Last update:2017
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
100029460|F|0100029460|F|0Citrus spp.marker_locus
100029460|F|0100029460|F|0-139.51Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-C.sunki_x_Rubidoux-C.sunki-F1-2018Group 4N/A108.39100029460|F|0View
2Citrus-Murcott_x_Pera-F1LG04aN/A139.51100029460|F|0View
Sequence
>100029460|F|0 ID=100029460|F|0|Name=100029460|F|0|organism=Citrus spp.|type=genetic_marker|length=69bp
TGCAGTTGGATAGCCTTGACCAGTCGTGAAAAAACATTGGGAAATTTACA
CCAATAGCCATAAAAATTT