100079941|F|0

Marker Overview
Name100079941|F|0
Genbank IDN/A
TypeDArT
5' Flanking SequenceTGCAGGATGGCTTGAAATTTGAAAAGAACA
3' Flanking SequenceGCGCTTTTCCTCCTTACAGATCGGAAGAGCGGTTCAGC
SpeciesCitrus spp.
Publication[view all]
ContactMaiara Curtolo
Contact
NameDetails
Maiara Curtolo
First name:Maiara
Last name:Curtolo
Institution:Centro APTA Citros Sylvio Moreira
Email:maiaramc@hotmail.com
Last update:Jan 2020
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
100079941|F|0_30_C>T100079941|F|0_30_C>TCitrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-C_sunki/Rubidoux-F1-Rubidoux-2020LG01-1N/A106.41100079941|F|0_30_C>TView
Sequence
>100079941|F|0 ID=100079941|F|0|Name=100079941|F|0|organism=Citrus spp.|type=genetic_marker|length=69bp
TGCAGGATGGCTTGAAATTTGAAAAGAACAYGCGCTTTTCCTCCTTACAG
ATCGGAAGAGCGGTTCAGC