Sc_4_02 | Citrus Genome Database

Marker Overview

Marker Overview


Name	Sc_4_02
Genbank ID	N/A
Type	SSR
Species	Citrus clementina
Repeat Motif	(AAT)10
Primer 1	Sc_4_02.Forward: GCGAGAGAGTGCGCCTAATA
Primer 2	Sc_4_02.Reverse: AATTGAGCCCAGCCCAGATC
Product Length	289
Publication	[view all]
Contact	Kwan Song

Contact

Name

Details

Kwan Song

First name:	Kwan
Last name:	Song
Institution:	Jeju National University
Country:	Korea
Email:	kwansong@jejunu.ac.kr
Last update:	Apr 2018

Publications


Year	Publication
2018	Chang Y, Kim H, Oh E, Yi K, Song K. Construction of genetic linkage maps of ‘Fina Sodea’ clementine (Citrus clementina) and Byungkyul (C. platymamma), a Korean landrace, based on RAPD and SSR markers. Horticulture, environment and biotechnology. 2018; 59(2):263-274.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Fina_Sodea/Byungkyool-F1-Byungkyool	B03	N/A	24.6	Sc_4_02	View
2	Citrus-Fina_Sodea/Byungkyool-F1-Fina_Sodea	C07	N/A	42.5	Sc_4_02	View