BM-CiSSR-137

Marker Overview
NameBM-CiSSR-137
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(TAT)7
Primer 1BM-CiSSR-137.Forward: GCAACGTGTACTGACGCTTG
Primer 2BM-CiSSR-137.Reverse: GCTCGTATCTGAAGCTCGCC
Product Length292-330
Publication[view all]
ContactHo Kim
Contact
NameDetails
Ho Kim
First name:Ho
Last name:Kim
Institution:Life Sciences Research Institute, Biomedic Co.
Email:hobang@ibiomedic.co.kr
Last update:Jun 2019
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBM-CiSSR-137.ForwardCitrus clementinaprimer
ReverseBM-CiSSR-137.ReverseCitrus clementinaprimer