BM-CiSSR-159

Marker Overview
NameBM-CiSSR-159
Genbank IDN/A
TypeSSR
SpeciesCitrus clementina
Repeat Motif(GAGG)5
Primer 1BM-CiSSR-159.Forward: ATGACCTCAAACGGTGAGCA
Primer 2BM-CiSSR-159.Reverse: CTTCCACATCCGAACCGACA
Product Length378-404
Publication[view all]
ContactHo Kim
Contact
NameDetails
Ho Kim
First name:Ho
Last name:Kim
Institution:Life Sciences Research Institute, Biomedic Co.
Email:hobang@ibiomedic.co.kr
Last update:Jun 2019
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBM-CiSSR-159.ForwardCitrus clementinaprimer
ReverseBM-CiSSR-159.ReverseCitrus clementinaprimer