CIRAD_S1_28191987

Marker Overview
NameCIRAD_S1_28191987
dbSNP IDN/A
TypeSNP
SNP AllelesC/A
5' Flanking SequenceTTCCTTGCAATACATAGACCTCTCAAACAACTCTCTAACTGGCGAAATTC
3' Flanking SequenceTCTGAAGAATGAATGCGAGCTGAGAAACTTGAGGTTTCTTCTTCTTTGGT
SpeciesCitrus spp.
Publication[view all]
ContactPatrick Ollitrault
Contact
NameDetails
Patrick Ollitrault
First name:Patrick
Last name:Ollitrault
Title:Researcher
Institution:CIRAD
Address:Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:France
Email:patrick.ollitrault@cirad.fr
Phone:+33(0)467615971
Fax:+33(0)467615666
Last update:Jun 2020
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
S1_28191987S1_28191987Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-GiantKeyLime-F1LG01N/A24.9S1_28191987View
Sequence
>CIRAD_S1_28191987 ID=CIRAD_S1_28191987; Name=CIRAD_S1_28191987; organism=Citrus spp.; type=genetic_marker; length=101bp
TTCCTTGCAATACATAGACCTCTCAAACAACTCTCTAACTGGCGAAATTC
MTCTGAAGAATGAATGCGAGCTGAGAAACTTGAGGTTTCTTCTTCTTTGG
T