EH406253

Overview
NameEH406253
Unique NameEH406253
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length449
Libraries
Library NameType
AbsCOv1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAB2CA02ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406253 ID=EH406253; Name=EH406253; organism=Citrus clementina; type=EST; length=449bp
GGCAGTCACAGATACACAGGAAAGAGAGATATAATCAATCATCAAGGTTC
CAAGAATGAAGAAGCCCGCGAAGAGCCACGGCCACGGTGCAAGAAACAAA
TCAACAACAGATCAGCGGAGTGACAAGAAATCCGCAACTGGCATGAACGG
ATCGCCCAAAAAGAAAGGCCACGGAGGCAAGTTCACGTGGTCAGGCGACG
GTTACTCGCAGGCTGAGATCGGCTTGGACGAAGCCATCGATGCTAATGAT
CCTAACTATGAAGATCCTGAAGATCAGAAAGAGACCGTCGCCGTTTGATT
TTCACTTTGATTCCGGTGATTTAATGCTTTATGATCGTCGTTGTTTAATG
TTTTATTTAATATTCGCTCTTTTAATCTTCAGATGAGATGAGATTTAGAT
GTAAATACCTTGTGATTTCGTCTTTCAATAAAATCCGTCCGTCTTTCTC
back to top