EH406257

Overview
NameEH406257
Unique NameEH406257
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length354
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2BH12ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406257 ID=EH406257; Name=EH406257; organism=Citrus clementina; type=EST; length=354bp
TGAAGGCAATCAAACACTGAATTGGATTACGATATGAAGAGCAGTTGTTT
GAAGAAAGTTGAAGTTACTGGACATGGTTAAGGTTCTGTTGTAACTAGTT
CTTGTTATAAGGCTGTGAAGATAAAGAATATTTGGTGCAGGCCATGAAAT
CAAGAATTTTTAGCTAAGTGTTGAAGGCAACTTGAAGATATAGTACTAGA
TTTGTTTTCCCTAATTTTTTATCATTAGAAAATATACAAGTATGACACAA
ATATACTTATCATTGTGTCTAATTTTTTAAGTAATTGGATGTTCACATAT
TATTACATAATTGAATTAGATGAACAATGAATTGTATGTATAATTAGTAG
CCTT
back to top