EH406259

Overview
NameEH406259
Unique NameEH406259
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length470
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2BD09ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406259 ID=EH406259; Name=EH406259; organism=Citrus clementina; type=EST; length=470bp
GATTGGATATTTGATATAAATATAAGAAATTGATAGGCATGGAAGTGCTT
TGGCAAGAAGGCCCTCATGGCTCTTAGAAAAAAGCATCAAGTTCATGGAG
AGGGATATATTCTGACGACCCTCCTCCTCCAAAATTCAACAGTTTGTCTG
TGCTTCACTCTTTTAGCTCTCTGTTAGCCACTGAAGCAGCAGCAGCATTA
AAATCTACCAGAGGCTTTTGGCTAATGCATGGCAAACCGGCAAGTCACGA
AACGGCAATGGGCTCGGCTATTGAATCTTGTTATGGCTTTTTTTACTTTT
TCTCTGTTTTGAAGTAGTACTGTAGTTCTTGCATGAGTATGGAATAAAAA
AGTTGTGTTAGTGTGTGTTGTGTATAAGCTGCAGAAGATCAGCAAGTTGA
TTTGTTTAACTGACGAGTTTCTGCAAATCAAGTTGATAATAAGATGGTGA
TCTGATCACCTTTTCCTGCC
back to top