EH406261

Overview
NameEH406261
Unique NameEH406261
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length303
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CC01ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406261 ID=EH406261; Name=EH406261; organism=Citrus clementina; type=EST; length=303bp
GGTGGCAAGGCCTTGGAGGGTAAGGTTAAGTCCTCTGTTAGGGCTCAGGT
TGTTAATGTTGCTCATGTCACTAGCAATGCCCTTTCACTGATCAATAAGT
TTGCTGGGAAACACTGAGCCGTAGTTAACCATATGGCTGTGTGAATGTTT
TGCGAGAGTTTGTGTCTCTTTTTATCTTTGGTTTAGTTTTAATGTACAAA
TTAATCATCAGTTATAAGTGAGTGTTAATTTTGAGCATATCTATAAAAAT
GAGCTTATGTGAATGAGCAAAGATTCTTGTCTTTTATGGAAAAAGTTTTA
TTT
back to top