EH406262

Overview
NameEH406262
Unique NameEH406262
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length291
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2BG08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406262 ID=EH406262; Name=EH406262; organism=Citrus clementina; type=EST; length=291bp
GACGAAACCAAGTACGAAACTGATCATTATTGGTACGGACACGGATATGG
CCATGGACATAAATATGGTCATGGCAAGGGATACGGACACGGTGGATATG
GACATTACGGCAAGCCTGGCCATGGAGGTCACCCCGGACACGGTGCTGAT
GGAGTTGAAACCGAAGATGGAGGGAACTAAATAAACCCTTGCTAACCTAG
CTAAGCCTTCTTCTTCTTCTTCCTTGTTGGCTAAGCTAGGTCTTTTATGA
ATGTGTTGCTTGCTGAAATAAATAACTAAGCTTTAGTTTAC
back to top