EH406263

Overview
NameEH406263
Unique NameEH406263
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length373
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CA08ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406263 ID=EH406263; Name=EH406263; organism=Citrus clementina; type=EST; length=373bp
GGTCTTTTCCTTGTGTTGCTATTAGAATTATTGTCTATCCCTTTTTTGCC
TTGTGGAAAGAAATGTATGAATCGGCAGCATAATAGAATGTTGTTGGAGC
ACCTTCAAGGATTCTGTAGCAGCTTGGTAGCATCAACAGATGCGGTGGCT
GCTGATAGAATAGCTCAGCTGACAGCTTGGCATGTATACTCTTTTTTCCC
AATTTTAATTTGAGCTATGGAATTGTTTTCAAAGTGTTTGCTAGGTTCTA
CGTTTCATGCTTGTGCTCATATTTTAAAGGAAAGGGTTGTACATGAAGCC
CCGTCGCGTTTTCATAAGAATGTATTTTCTATGTTCTAATAATAAAGAAC
TGAATATCCTAGATGTTGCCTCA
back to top