EH406264

Overview
NameEH406264
Unique NameEH406264
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length402
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB2CC11ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH406264 ID=EH406264; Name=EH406264; organism=Citrus clementina; type=EST; length=402bp
ATGGCGGAAAAGGAAGATGGAACGAGCCAGGCAGCGAGAACTGGAGAAAA
ATGGAACCACCACCTCTCAAGCGTGATGTCTTTTGCGGCCAAAATTAGTG
TTGCGGACTTGCAGTTCATATTATGAAATATTGGATGCTGGATGCATTAA
ACATTGTGACCATATATGACTATATGAAGGGGAAAAAAATCTCTAAGCAT
GTAACGGTTAAGTTATAGCAATACCGATATAATAACAAAATAAGAGTTTC
TATCCTTTGAATATATATTCTGTACATTATACCTTGTCTTCATAATGTAC
AAGCAAATGTTTATTATGTAACTTTTCTGTGGCCTATGGGTGGATGGCTG
ACAGATAAGTAACTTGCATTATTTACCTCTGATTCTGAACTTTTTAATTC
CC
back to top