FC868495

Overview
NameFC868495
Unique NameFC868495
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length574
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9353 contig Ccv1_Contig9353:29..602. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31001A10EF AbioticL1 Citrus clementina cDNA clone C31001A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868495 ID=FC868495|Name=FC868495|organism=Citrus clementina|type=EST|length=574bp
GAATAAACTATCTTCATATCCACTTCCACTTCCTCTTCTTCTTGTCCACT
TTGCTTCTCCAAACTTCAAACTTCAAACTTCAAACTTCAAACTTCACACT
TCTCCTGAAACCTCTCACGAAACACTCTTTCAAATCCCTCTATTCTGAGT
GATGGGTATGAGCAGCCGCTGCTCCCACACATCTCACATAACCGAGATCA
TAATCACCAGCTTCTTTCGTCATAAGTCTTAAATTAAATTTCTTCTCGAC
TGTTGAATCATCGCATCATCTTTAGCGATGGCTGCTTAAAAGATTAAGAA
TATTAGTTTTAAGTTAAATGGCGGGTGGGAGGATGTATAATCAAAATAGT
TCTAGTGGTGGTGGTAGTGGTGGTGGTACTTCAAGTCTGTCCTTTCTGAT
TCAAAGCCAAAAGGGTTCTTGCTCTAACTCTCAGAATCTCGATGCTTCGT
TCCTCTCTGGACCTTCTCCTTCTCCTTCTCCTTTTCTTGGATCAAGATCC
ATGGTGAGCTTTGAAGATGTGCACTTAGCAAATGGATCCAATAACAGGCC
ATTTTTCCGCCAATTTGATCGTGA
back to top