FC868496

Overview
NameFC868496
Unique NameFC868496
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length349
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC868496_ssr28 microsatellite FC868496_ssr28:28..39.
FC868496_ssr72 microsatellite FC868496_ssr72:72..83.
Properties
Property NameValue
Genbank descriptionC31001A11EF AbioticL1 Citrus clementina cDNA clone C31001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868496 ID=FC868496|Name=FC868496|organism=Citrus clementina|type=EST|length=349bp
TTTTTCCCCTTTGTCTTTGTCTTCTTGTCTCTCTCTCTCCTTCTCTCCTG
ATGCCCACAAGAAAGAAACCCTCTTCTTCTTCTTGATTTCTTCTATTTTT
CATCCTGTCTGTGAAGCAAACAGAGAGGAAAACAAGAAAGAATTAGAAGA
AGAGGAGATACAACATAGAGAAAGAGAAAGAAGAATTATTGTTAAGACTC
TTATCAAAGGTCAAAGCCCATCCCCCACCCCCAATGGACTCAGCATCGTC
AGCCACAGCTGCTGCTGCAATTTTTAATGAGAGAGAGTCCATGGTGGATC
CATTTTTGGTTGAGGCTCTCCAGAATCCTCGTCATCGTCTCACCATTCT
back to top