FC868504

Overview
NameFC868504
Unique NameFC868504
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length586
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8374 contig Ccv1_Contig8374:38..623. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31001B12EF AbioticL1 Citrus clementina cDNA clone C31001B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868504 ID=FC868504|Name=FC868504|organism=Citrus clementina|type=EST|length=586bp
CCTCGGGGGGAGTAAGAAGACCGACAGAGTTCAAGCCAGACACTGAAACT
GAAGCCCAAATCAAGCCGAAAAATGGCGGAATCTCCGCTCCAGTTAATCA
TATTCCCTATTTTCAAAATCTCCTAATCCCCATATAATAACGAAATCATT
TCACTAAAAAATTCAGCTTTAGGTTTCGTTCTTTTGATTGCGTTTTTAAA
AATGAAAGCGTCTTTGAAATTCCGTGAAGAGCAAAAGCCTCTGTTTAGAG
CTAAAGTGCCCTTATCAATTTTAGGGTTACCTTTTCGGTCAGGAATTGTC
GCTGGCGAGTCCAGAGAGCTCAGTCTAAACCTGTCCACTTTCTTCGAATC
TGGGCCGTCCATCAAGATCGGTTATCGTCCGAACGACACGTGGAATCCGT
TTTCGCTGATTGTGAAAACCGGAACTGGACCGTTCGGTTCGCCTGTCTCT
AGCACGATGCTGATGAGCGCCGAGTTCAATTTGCTTGGTCGGGGGAATCC
GGCGTTTATGCTTCATTTCAAGCCGCAGTTTGGGGATTTCTCGATTAAGA
AGTCGCAGTCGTCGGTTTTGGATCAGATAGCAATTT
back to top