FC868545

Overview
NameFC868545
Unique NameFC868545
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length391
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9352 contig Ccv1_Contig9352:1..391. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC31001G04EF AbioticL1 Citrus clementina cDNA clone C31001G04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868545 ID=FC868545|Name=FC868545|organism=Citrus clementina|type=EST|length=391bp
TGGTGGGTATGATTCCAATCCGGGGTCGGAGACCTCTCAGGTGACACTGG
AGGCACTGATGCTGGTCTTGACGGCAATCCTGAGTCTGGGCTTGACGGAA
ATCCTGAGTCTGGGCTTGACGGAAATCCTGAGTCTGGGCTTGACGGAAAT
CCAGAGGTTGGGTTTGGTGGGAGGCAATGAGAGTGGCAGTATCATAGAAG
GTTTTGCCCTATCCCTCCAATGGAAGCGATCATAGCATAAGGATTATAAA
ATTTGTCGGACTGTTCTTTGTCTTAGTGTTGGCCGCATTTTATTTTTGAA
CTGCTCTTGTTATTTATGCCGGATTTTCTTGATGAACAAGGAACACTTGG
TTTTTTTTCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top