FC868557

Overview
NameFC868557
Unique NameFC868557
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length714
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31001H05EF AbioticL1 Citrus clementina cDNA clone C31001H05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868557 ID=FC868557; Name=FC868557; organism=Citrus clementina; type=EST; length=714bp
GCTCTTGAAATCTCTCTCTAGCCGAGCTCGCTCGCTCTTTACGCGTAGCA
GAGTTTAAAACTAAAATCTTTCACGAGAGAGAGAGAGAGAGTGAGTGAGT
GAGTTGAAAAAAGAAAATTTTTTATTAGTTGATTTTAGTCCTCCAATCAG
ATCAGAGAGGATGCAGCAATCTAACGGCGGAGACGCGAACGCCGCGGCGG
CGGTGTCCGGAGGAGCTGGAGGAGGATCTCAGCCGACGCCACAGCAGCCA
TACCACTGGGTCCCGCCGCACCAGCAGCAGTGGATGGCTATGATGCAGTA
TCCGGCGGCGGCGATGGCCATGATGCAACAGCAGCAGATGATGATGTATC
CTCATCATTATATGCCGTACGGCGGCGGCGGTCACCCGTATTATCAGAAC
GGCGGCGGCGTAAAGCAGCAGCAGCAGCAGCAACATGGATTGAGTAACGG
AAAACAAAACGGATCTAATAATAATTTTACTAATGACGAGACTAAGACTA
TATGGATTGGTGATTTGTTTCATTGGATGGACGAAACTTTTCTTCATAAT
TGTTTCTCACATACTGGTCAGGTTGTAAATGTTAAAGTTATCCGCAATAA
GCAAACTGGTCAGTCAGAAGGGTATGGATTTGTTGAGTTCTATTCACGTG
CTGCAGCTGAGAAAGTTTTGCAGAGCTATAGTGGGTCTCTAATGCCAAAT
ACTGACCAGCCTTT
back to top