FC868558

Overview
NameFC868558
Unique NameFC868558
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length658
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC31001H06EF AbioticL1 Citrus clementina cDNA clone C31001H06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868558 ID=FC868558|Name=FC868558|organism=Citrus clementina|type=EST|length=658bp
TCTTCATAAAAAATTTCAGCCATGGAGAGACACCAAGAACTGAAACGCCT
CGGCTTCTTTGGCATCCTCAAAGAATCCTTCAAGCTCATCTTCTCACTAA
AAAAGCTCTTCACTCAAATCTCACTAGCCCTTCTAATCCCCATCTCCATA
ATCCTCGAAGTCAAGATCCTCACCGCCATTTTGTTCTCATTCAACATGTT
TAAGAACAGAGACGAACCCGAAGATTTTACAGTCTTTATCATCCCCCAGT
ACTCAACCCTAAACATTTCTTATATAGCCTCCTTCAAATGGGTAGCTTTT
TGGCTTTTGTCCGAAATCACTTATCTCATTCTCCTTTTAGTCCTCTCCAT
TCTTTCCACCGTCACAATTGCTTTTACTACTGCCTCCATTTACAAATCAA
AAGAGACCACCACCTTCAAGAAGGCCGCCGCGGCGGTTCCAAAGCTCTGG
AAGCCAATTTTGATCACCTTCTTATTAGTCTTCGCCGTTACTTTTGCTTA
CGATTACATTCTTGGACCAGTTCTTGGATTGATCCTTCGGCTTCTTTTTT
TCAAAAATTCGCCGTCTTAAAAATCGTCATCGGTGTGATTCTCACAGTCT
TGTACATAGCAGTGTTTGTTTATATTACATTAATTTGGCATATGGGCACT
GTGGTTTC
back to top