FC868562

Overview
NameFC868562
Unique NameFC868562
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length759
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31001H10EF AbioticL1 Citrus clementina cDNA clone C31001H10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868562 ID=FC868562; Name=FC868562; organism=Citrus clementina; type=EST; length=759bp
GAGGGGCGTATTCCAAAAATTTCTTCCTTTACGTGATATGATGTGATAAT
AGGCCATAAAAAATATATCACCAAAGGAAAAGGATTGGCCTTTTTCCCCT
TTGCCTTTGTCTTCTTGTCTCTCTCTCTCCTTCTCTCCTGATGCCCACAA
GAAAGAAACCCTCTTCTTCTTCTTGATTTCTTCTATTTTTCATCCTGTCT
GTGAAGCAAACAGAGAGGAAAACAAGAAAGAATTAGAAGAAGAGGAGATA
CAACAGAGAGAAAGAGAAAGAAGAATTATAGTTAAGACTCTTATCAAAGG
TCAAAGCCCATCCCCCACCCCCAATGGACTCAGCATCGTCAGCCACAGCT
GCTGCTGCAATTTTTAATGAGAGAGAGTCAATGGTGGATCCATTTTTGGT
TGAGGCTCTCCAGAATCCTCGTCATCGTCTCACCATTCTGCGTATGGAAC
TTGATATTCAGAGGTTTTTGCAAAATCCTGATCAGCAGCATTTCGAGTTC
CAACATTTTCCTACTTCTTATCTCCGACTGGCTGCACACCGTGTTTCTCA
ACATTATGGGCTAGTAACTATGGTTCAGGAAAATGGCATAGAAGGGCTGG
GTAACAGGATTTTGGTGAGGAAAACAGCAGAAAAGCAATATCCTGCTGTC
CGTTTATCTGAGATTCCTGCTAAGCAGTCGGAAGAAAGTGATAAGCTTGA
AAAGATTAAAATGCCATCAGGCGTAGGCCCAATGCTGATGTGNTATGGAG
CAATGAACT
back to top