FC868649

Overview
NameFC868649
Unique NameFC868649
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length652
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31003A09EF AbioticL1 Citrus clementina cDNA clone C31003A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868649 ID=FC868649; Name=FC868649; organism=Citrus clementina; type=EST; length=652bp
TTCAGCTTCCTGCACCGGAGCTGAGAGAAATAGTGGACGCTCCGGCACTT
CCGTCGCTGTCGTTTTCGCCGCAAAGGGACAAAATCCTGTTCCTCAAACG
GAGTTCTCTGCTTCCGCTGGTGGAGCTAGCAAGGCCGGAAGAAAAGTTGG
CCAGTGCGAAAATCGATGTGAAATGCAATGGCAAGAGTAGAATGCCGTTC
TTCACTGGTATTGGGATTCATCGGTTGTTGCCTGATGACAGCCTTGGCCC
TGAGAAGGAGGTACACGGATACCCTGACGGTGCAAAGATCAATTTTGTCT
CCTGGTCACCGGATGGTAAGCGCATAGCCTTTAGCGTCCGAGTTGATGAG
GAGGACAACGTTAGCAGCTGTAAGCTTAGGGTTTGGATTGCTGATGCCGA
AACTGGTGAAGCTAAGCCTTTGTTTGAATCGCCTGATATCTGTTTAAATG
CGGTTTTTGGGAGTTTTGTTTGGGTGAACAACTCAACTTTGTTAATTTTC
ACCATCCCTTCATCACACAGAGACCCACCAAAGAAAACTATGGTTCCCTT
AGGCCCCAAGATACAATCTAATGAGCAGAAAAATATTATTANTAGTAGAA
TGACTGATAATTTGCTTAAGGATGAGTATGATGAGTCTTTGTTTGACTAC
TA
back to top