FC868654

Overview
NameFC868654
Unique NameFC868654
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length691
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31003B04EF AbioticL1 Citrus clementina cDNA clone C31003B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868654 ID=FC868654; Name=FC868654; organism=Citrus clementina; type=EST; length=691bp
GAAAAAAACAAACCCATTAATAACCGATTCTCTCCAAACAAAACATCATC
TGTTTCTAGATACCTCAACTCAGCATGGCCTCTATTTACCATCTTGTTAT
TCTCTCTTCGCTTCTCTTGCTCTCCCATTTTTCATGCTTTGCTTCTACGA
GAAAGCTCACGGCTCTCGCGGAACAACATCCCCTCGTTTTAAAGTACCAC
AACGGCCAACTTCTTAATGGCAACGTGACTGTTAATCTTGTTTGGTATGG
CAAGTTCTCTCCAATACAGAGGTCTATCGTCGTTGACTTTCTCAAATCTC
TAAGCTCTGCTAAGACCCCGCCACCTTCTGTCTCTTCTTGGTGGCAGACC
ACTGAGGCCTACAAAGGCGGCCCACGCTCCGTCGTTGCTGGGAATCAAGT
CCTTGACGAGAATTACTCGCTTGCAAAATCCCTCAAGACCCCGCAAGTTA
TATCCCTGGCTTCCAAAGCTGGGATTAAAAATAACGCTGTTAACGTCGTT
TTGACTTCATCCGACGTGGTGGTCGATGGGTTCTGCATGAGTCGCTGTGG
GACCCACGGGGCTGGTCGAAGCAAGGAGAGCAAGTTCGCTTACGCCTGGG
TTGGGAACTCGGAGAGTCAGTGCCCGGGCCAGTGCGCGTGGCCGTTTCAC
CAACCCATTTACGGCCCCCAACTCCGCCCTTAGTTGCCCCT
back to top