FC868660

Overview
NameFC868660
Unique NameFC868660
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length702
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC31003B10EF AbioticL1 Citrus clementina cDNA clone C31003B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868660 ID=FC868660; Name=FC868660; organism=Citrus clementina; type=EST; length=702bp
GAAGTGCTTTAGTTCTCACATAGAGAGAAATAAGTTCCCAAACTCTAGGC
TAAGCAATGGCTAGTTATGGCTACCCCTCTAAAGCCTACCCTGCTTACAA
TGATTTAACACCATGGGTAAATTATGGGGACAAAATCAGATATGCCCCCG
ATCATGTTTGCAAGCCAGTCGTTGTTGATGCTGATGGGAGGAAACATCCG
GTCGTTTCTTACACTCCCAGCAATAGCGCAGAAACCCGTGTTATAGAAAC
TCAAACCATTGTGATGCAGGAGGTCCGTTCACCTGTTGTCAATGGCAACA
CTGGTTATGGACATGTTAAAGATACACCTTTTGTCAATGGATACAAACAT
AGTTCTCCCGAGCATGGGCATGGCAATCCTGGTTATGGACATGTTGATGA
TAAGTGGTATAGGTCTTCAAATCCAGATCCTGGCCGGGATAAGTGGTATA
GGTCTTCAAGTCCAGATGATGGCCGCGATAAGTGGAATAGGTCTTCAAGT
CCAGATGATGGCCGCGATAAGTGGCAGAGGTCTTCAAGTCCAGATCATCA
TGGCCGCCCTCATAAGGTTAAGGAGTTTCTCACCAAGGTGCAAACTGAAG
CTAGTTTACCGAAGAGGTTTGGTCTTTTGAGTCCTTCAGTTTGGCGCCGG
TCTCCTGATCCACAGGCCATCATGGGCATGGGCCTGGGAATGGCAATACC
GG
back to top