FC868676

Overview
NameFC868676
Unique NameFC868676
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length704
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:142..846. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31003D05EF AbioticL1 Citrus clementina cDNA clone C31003D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868676 ID=FC868676|Name=FC868676|organism=Citrus clementina|type=EST|length=704bp
AGTAGCCCTCGCAGTCCAAAAAATGATTTTCCTACTACTCCTCTCCGTTT
TTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACACCTATTAGC
TTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAGACCCTCAT
TTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCACACCAGGCC
CTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTATACGGCAAG
CCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACCATTAAGAT
CTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCATGACGTTCA
TTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCGGCGAATAT
CTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTAGCCGTGGA
GCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATGATAACCATA
TTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAATAGTCTGCTT
GACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAATTTATTACAA
TCCAGACTTTGGACAACTCTCTGTTTATGCGGCATATTCGGGGGAAACAC
TTGTGAAGGTGGTTGAAAAACCCATTAACCTGTCAGATATAATTCCACGN
CCGT
back to top