FC868759

Overview
NameFC868759
Unique NameFC868759
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length738
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC868759_ssr25 microsatellite FC868759_ssr25:25..50.
FC868759_ssr285 microsatellite FC868759_ssr285:285..294.
FC868759_ssr471 microsatellite FC868759_ssr471:471..488.
Ccv1_Contig8267 contig Ccv1_Contig8267:78..816. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31004D11EF AbioticL1 Citrus clementina cDNA clone C31004D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868759 ID=FC868759|Name=FC868759|organism=Citrus clementina|type=EST|length=738bp
GACGCTAAGGAAGCGAAAGAGACCGAGAGAGAGAGAGAGAGAGAGAGAGA
GTTTCGTTATCCTCCTCCTTTCCTCCATTTGAAAATTCAATGCCGCAAAA
CAGAGAGGGCGTGTAGTTTCTGTTTTTGGTTCTCAAGGCTCAAACTGAAC
GTTAAGTTTTTGTGGATGGGCATGCACGCTTCTCCACCATAAGCGAGAAG
CCAAAAGAAGCAGTCAATCATCAAACGTATAACGCACACGAAATCTACAT
CCAAGAATACTTCGCAGAAGAATCACTAAAATGGCTCTCTCTCTTCTTCC
TGTTTCCTCTCCTACATTCCCTCTTCATCATCCTCCCTCTTCTTTATATC
ACCACCATCCTCACCGCACAAAGCTCCAAGCACTAGTCTTTCGAAAATTT
TCTCTTGGCAAAGAACGGGTGAGGGGTGGCTTTATGGGGAAAAAGGGAGG
TGGGTTTTTATGGGTGTCGCCGTCGTCGTCGTCGTCGTCTTTATCCGTTT
GTTGGGCTAGTAATGGTGGGGGAGGGGATTTGGGGAGAGATAATTATGAG
GAAGATGATGAAGCTGGAGATGAGAGCGAGGCTGATGATGATGGAGACGA
ATATGATGAAGAGATCAGTGGGTCTGCTTCTGTCTTGCCTGAGAGATGGG
ATGTCTTAGGCCTGGGCCAGGCTATGGTAGATTTTTCTGGCATGGTTGAC
GATGATTTTTTGAGAGACTGGGATTAGAGAAGGGACGA
back to top