FC868788

Overview
NameFC868788
Unique NameFC868788
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length722
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:133..855. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31004G09EF AbioticL1 Citrus clementina cDNA clone C31004G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868788 ID=FC868788|Name=FC868788|organism=Citrus clementina|type=EST|length=722bp
GGAGAAATAAGTAGCCCTCGCAGCCAAAAAATGATTTTCCTACTACTCCT
CTCCGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACAC
CTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAG
ACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCAC
ACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTAT
ACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACC
ATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCAT
GACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCG
GCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTA
GCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATGA
TAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAATA
GTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAATT
TATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCATATTCGGG
GGAAACACTTGTGAAGGTGGTTGAAAAACCCATTAACCTGTCAGATATAT
TCCAACGNCCGTCTATGTTGGA
back to top