FC868792

Overview
NameFC868792
Unique NameFC868792
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length729
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7452 contig Ccv1_Contig7452:346..1074. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31004H01EF AbioticL1 Citrus clementina cDNA clone C31004H01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868792 ID=FC868792|Name=FC868792|organism=Citrus clementina|type=EST|length=729bp
GAAGGGAAGATTGTAGAAGGAACCGCGAGCAGAGGAAATAAATTTGAGCT
TGGCGTTAGTAGGTAGCAAAGCAGGTAATGAGCAATGGCTCCGACCAGGA
AGACAGAACCAGAAACCAGCAAGAAAGGGAGGACCTCATCAAAACTCTTT
GTGCCGGCTTGTTATTCGTTTGGGTTCTTGCTCGTCTGTTTGATTGCTTT
TTTACTTCAAATAGTCTACTTCTCGCCAATATCTCCAGTCTTGGATGAGG
TGCCCCAGCCCGCTGTGTTGTCAGCCACTCAGTTACAGGATTTTATTAAA
GTTGGAGAGGGAAGTGTGAATCACCCGGAGGATGCTTCTGTGGATAAAAA
TGGCGTGATATATACAGCTACAAGAGATGGTTGGATCAAGAGATTGCAAG
ATGGAACTTGGGTCAATTGGAAATTTATTGACAGTCAAACTCTACTTGGA
CTTACATCGACCAAAGAAGGCCATCTAATTATATGCGACAACGCAAACGG
TTTGCACAAGGTCAGCGAAGACGGCGTAGAGAACTTTTTATCATACGTCA
ATGGTTCTAAACTGAGGTGTGCAAATGATGTAGTTGAAGCATCAGATGGT
AGTTTATATTTTACTGTATCAAGCTCCAAATATTTACCCCGCGAGTATTA
CCTGGATATTCTTGAGGGGAAAACTCATGGTCAGCTACTCAAGTATGATC
CTTCATCCAATATAAACACACTTGTGGCT
back to top