FC868807

Overview
NameFC868807
Unique NameFC868807
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length711
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13292 contig Ccv1_Contig13292:133..843. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31005A07EF AbioticL1 Citrus clementina cDNA clone C31005A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868807 ID=FC868807|Name=FC868807|organism=Citrus clementina|type=EST|length=711bp
TTGAGTGGAGCTGCTCTTTATCTGCTCGGCCGGAGCAGTGGCAGAGATGC
AGAGCTTCTTAAGACAGTCACGCGTGTCAATCAACTCAAGGAGTTGGCAC
ACTTGCTTGATAGTGGAAGTAAAGTTTTGCCATTCATTGTTACGGTCTGT
GGAAGAGTTGGCTCTGAAACACCAATTAGCTGTGAATATAGTGGGTTGAG
AGGCGTGATTGTTGAGGAAACGGCTGAACAACACTTTCTGAAACACAATG
ATGCCGGGTCTTGGATCCAAGATTCTGCATTAATGTTGTCAATGAGCAAG
GAGGTTCCTTGGTACCTAGATGATGGGACTGGCCGTGCATTTGTAGTGGG
AGCCCGTGGTGCCACAGGTTTTGTATTGACTGTTGGAAGTGAAGTTTTTG
AAGAGTCAGGACGATCACTTGTACGTGGAACATTAGACTACCTCCAAGGC
CTCAAGATGCTTGGAGTCAAGCGTATTGAACGGCTACTACCAACCGGCAC
TTCGTTGACTGTAGTTGGAGAGGCTGTGAAAGACGATATTGGAACAGTTA
GGATTCAGCGACCACACAAAGGGCCTTTTTATGTATCTCCCAAAACAATT
GATGAGCTCATTGAAAACCTTGGGAAATGGGCAAGGTGGTACAAGTATGC
CTCTTTTGGTTTAACATCTTCGGCACTTTCCTGATTTGCTAGCGTGCTAT
TCATTATATCT
back to top