FC868822

Overview
NameFC868822
Unique NameFC868822
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length121
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9765 contig Ccv1_Contig9765:30..150. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31005B10EF AbioticL1 Citrus clementina cDNA clone C31005B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868822 ID=FC868822|Name=FC868822|organism=Citrus clementina|type=EST|length=121bp
TCGCCGGGGACTACTTAGTATTGATTGACATCCCATTCTGCAGCTACAGA
AGTCAAGTAGAGATCATATCTATGGCGGCTGCAACATCCGGGGCTGTGTT
AAACGGATTGGGTTCTTCATT
back to top