FC868842

Overview
NameFC868842
Unique NameFC868842
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length680
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2504 contig Ccv1_Contig2504:353..1032. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31005E03EF AbioticL1 Citrus clementina cDNA clone C31005E03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868842 ID=FC868842|Name=FC868842|organism=Citrus clementina|type=EST|length=680bp
CTGGATCGACATTCTTTCCTCATCGAAAGATCCTGATTTCGCCTCTAGGG
TTTTTCATCTCCTCTCGCCCAACGGCGTCGTTTTCAACTCGATTTTCTCC
ATTGACCGTAAATCTCTGGTCAAATTCGTCTTCCCGACAGAACGATTACC
GGAATGGGCCCGGTTCATGCTCTCTTCTGAAAAGGACGTTAAAATTCTCT
CAAATTTGTGCCCGCTGTTCAAAGGTAAAGCGAAAGCTGATTCAATTAAG
AGTCCAGGTTCAGTGTACCAGGTTCAGTTAAATGTTTTCGAGTATTACAT
GTTTTGGTTTGCTTATTACCCAATATGCAGAGCAAATAATGAAAACAATG
TTGACAATCTCTTAACTAAAAGGACCAAAAAGGAGAAATTCAGGTTAGAG
AATTGGACATATTCAATTCCTGGGTTTTCTAGCAATGCTAAGCGTGTACC
AGAGCAAAAATTTGAGTGTAATCTTTACTTACGCCTATTGTATGCATATT
TACGTGAATTTGTGCCTATTAGTGATCTAAATATGCACCAGCACCCCTAT
CGTAGCTCACTTTTGAATTACACTAGTGGTTATGATGGTTCAGTTTTATT
GTGTGCGGAGTTTCTGGTTGATGCATTTCTGAACTATTGGCTGATTGATA
ATGATTTTTCGCCTTTGAGTGTTAATGTGT
back to top