FC868981

Overview
NameFC868981
Unique NameFC868981
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length703
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31007C04EF AbioticL1 Citrus clementina cDNA clone C31007C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868981 ID=FC868981; Name=FC868981; organism=Citrus clementina; type=EST; length=703bp
GAATAAAAGATTTGTTGAATACCAACAAAACACTTAACTGCAACTGCATC
GAAGAAGGAGAGTATCCAAAATTCATGGCCCCGACGCTTACTTCCTCCAA
TTCATTTCTGCTCAATACAACACCCCGTTCAAGGCTCATCGTCAAGAACT
CAAGATTCAGTGTGTTTGCCAAGAAAGCTGGACCGTTCCCTCCATTTCAG
CTTGGCAAGTCGAAGGATGAGAATTCATCTGATGAAAGCTCAAATGGTGA
TTCCGGCAATTCCAATCCTTTTCGCTTCAACTTTGGTAAGGTGCGGGATG
TGACATCTTTGATCCCAGTTGTGAGCAGCCCTGGAACTGGGCTGTCATTT
GGAAACTCTAGAAGGAAAGACTCTGGTACGGTTTTTGTGGCTGGTGCAAC
CGGGCAGGCCGGTGTTCGCATTGCCCAAACGTTGCTGCGTGAAGGTTTTA
GTGTTAGAGCTGGTGTCCCGGAGCTCGGTGCTGCTCAGGAATTAGCTCGT
CTCGCTGCCAGCTATAAGATCTTATCCAAAGAACAGTTGAAACGTCTCAA
TGCCGTTGAATCCAACTTCGACAGCGCAGAATCAATTGCCAAAGCAATTG
GGAACGCCGGCAAAGTAGTGGTCACGATTGGTCCCACGGAAGACGGTCCC
ACCAGCGAAGTCTCCACATCAGACGCTTTTCCAGTAAATCCAGCCGCTCA
ACT
back to top